Effect of Isolated Gut Probiotics Bacillus Oleronius on Hematological Changes in Cyprinus carpio var.koi
Abstract
Ornamental fish are those small size, colorful fish. Probiotics are live microbes, utilized as a
nourishment partner. The aim of the present study was to identify the isolated probiotic bacteria
from Labeo rohita to find its effect on hematological changes and digestive enzyme activities in
Koi carp. Koi carp fingerlings in the control tank were fed only with supplementary fish feed
and the fish in the experimental tank were fed with identified probiotics blended with
supplementary fish feed (3% body weight of fish).The hematological changes and digestive
enzyme activities were analyzed on 0, 15th, 30th, 45th, 60th and 75th day of the experimental period.
Among the isolated bacterial strains, Bacillus oleronius was identified as a probionts based on
the Biochemical Test and 16srRNA sequencing
(TGTAACACCCGAAGTCGGTGAGGTAACCTTTGGAGCCAGCCGCCGAAGGTGGACCAGAT
- Sequence ID :N R _ 043325.1).
Increased blood parameters, were recorded in the experimental fish. Result reveals that
isolated probiotics improved the growth and health status of fish.





