@article{et al._2020, title={Effect of Isolated Gut Probiotics Bacillus Oleronius on Hematological Changes in Cyprinus carpio var.koi}, volume={29}, url={http://sersc.org/journals/index.php/IJAST/article/view/4853}, abstractNote={<p><span class="fontstyle0">Ornamental fish are those small size, colorful fish. Probiotics are live microbes, utilized as a<br>nourishment partner. The aim of the present study was to identify the isolated probiotic bacteria<br>from Labeo rohita to find its effect on hematological changes and digestive enzyme activities in<br>Koi carp. Koi carp fingerlings in the control tank were fed only with supplementary fish feed<br>and the fish in the experimental tank were fed with identified probiotics blended with<br>supplementary fish feed (3% body weight of fish).The hematological changes and digestive<br>enzyme activities were analyzed on 0, 15</span><span class="fontstyle0">th</span><span class="fontstyle0">, 30</span><span class="fontstyle0">th</span><span class="fontstyle0">, 45</span><span class="fontstyle0">th</span><span class="fontstyle0">, 60</span><span class="fontstyle0">th </span><span class="fontstyle0">and 75</span><span class="fontstyle0">th </span><span class="fontstyle0">day of the experimental period.<br>Among the isolated bacterial strains, Bacillus oleronius was identified as a probionts based on<br>the Biochemical Test and 16srRNA sequencing<br>(TGTAACACCCGAAGTCGGTGAGGTAACCTTTGGAGCCAGCCGCCGAAGGTGGACCAGAT<br>- Sequence ID :N R _ 043325.1).<br>Increased blood parameters, were recorded in the experimental fish. Result reveals that<br>isolated probiotics improved the growth and health status of fish.</span> </p&gt;}, number={2}, journal={International Journal of Advanced Science and Technology}, author={et al., K Parvathi}, year={2020}, month={Jan.}, pages={3349 - 3356} }